| Detail of EST/Unigene SRR015436.326683 |
| Acc. | SRR015436.326683 |
| Internal Acc. | ESXKO2302J0K21 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=8e-25; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=2e-24; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Arabidopsis thaliana E-value=4e-24; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 2 OS=Zea mays E-value=6e-24; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 1 OS=Zea mays E-value=1e-23; |
| Length | 255 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGCATTAGAAACGATGTTGAGGTCTGGCTTGTATTCCTTTTCATTGACACCAACAACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |