Detail of EST/Unigene SRR015436.328003 |
Acc. | SRR015436.328003 |
Internal Acc. | ESXKO2302GWG3A |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=1e-21; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Bos taurus E-value=7e-15; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=4e-14; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=4e-14; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Gallus gallus E-value=4e-14; |
Length | 245 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGGGTGGAGAGTGCTTCATGGGATGGACGCTATGGTCTTGTAGTATGCACGGATAGCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |