| Detail of EST/Unigene SRR015436.331110 |
| Acc. | SRR015436.331110 |
| Internal Acc. | ESXKO2302FIW1O |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=1e-23; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Rattus norvegicus E-value=7e-13; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Mus musculus E-value=7e-13; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Cricetulus griseus E-value=7e-13; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=9e-13; |
| Length | 261 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGGGTTGATTGAAGGTTCTACGTTTGATCCGTTCAATTCTTTTGGCTCCAAGTTGTAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |