Detail of EST/Unigene SRR015436.331967 |
Acc. | SRR015436.331967 |
Internal Acc. | ESXKO2302FV4TS |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=1e-31; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=2e-31; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=6e-31; Naringenin,2-oxoglutarate 3-dioxygenase OS=Callistephus chinensis E-value=1e-30; Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=1e-30; |
Length | 256 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGCCAAAGTGTCCAGAGCCTGACCTTACTCTTTGGGCTCAAACGACACACCGATCCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |