Detail of EST/Unigene SRR015436.33734 |
Acc. | SRR015436.33734 |
Internal Acc. | ESXKO2301DYDCM |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=4e-29; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Sus scrofa E-value=2e-08; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Rattus norvegicus E-value=3e-08; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Mus musculus E-value=5e-08; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Bos taurus E-value=1e-07; |
Length | 261 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGTATGTTTTCGCTAAAGTTTAACGAAGGTCAACATCCTTTTAGTTTGTCAAACATTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |