| Detail of EST/Unigene SRR015436.35429 |
| Acc. | SRR015436.35429 |
| Internal Acc. | ESXKO2301AWRZ7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=1e-08; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-08; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=1e-08; Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=1e-08; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-08; |
| Length | 118 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGCACGGTTCTTGGCAAAGGTTTCAGGGTCTGCTGAGAGTCCAGCGGTATCCCAGCCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |