Detail of EST/Unigene SRR015436.44103 |
Acc. | SRR015436.44103 |
Internal Acc. | ESXKO2301AZQ01 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=8e-37; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=7e-33; Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=3e-32; Glutathione reductase, chloroplastic OS=Glycine max E-value=2e-30; Glutathione reductase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=5e-19; |
Length | 250 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGATCAAGGGCAGCATCAGAATCTATAGCATACTCGCTTCCAGGAATGTCTGGGATAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |