| Detail of EST/Unigene SRR015436.69165 |
| Acc. | SRR015436.69165 |
| Internal Acc. | ESXKO2301BPL3W |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=1e-13; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=1e-13; Cysteine synthase OS=Spinacia oleracea E-value=4e-13; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=5e-13; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=5e-13; |
| Length | 267 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGTATGGAGGGTACCCGGGGCATTGGTCTTGCGTCTATTGCAGCAGCTCGTGGGTATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |