Detail of EST/Unigene SRR015436.70499 |
Acc. | SRR015436.70499 |
Internal Acc. | ESXKO2301AIFST |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=3e-22; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=9e-21; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=8e-19; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-18; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=7e-18; |
Length | 260 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGGGACTCACCAGAGAATGGGCCCAAGTACTTAACACGGTCAGGGCCATACCATGGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |