| Detail of EST/Unigene SRR015436.81379 |
| Acc. | SRR015436.81379 |
| Internal Acc. | ESXKO2301C0D2X |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=2e-39; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Craterostigma plantagineum E-value=2e-39; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=2e-39; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 3 OS=Zea mays E-value=3e-39; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=3e-39; |
| Length | 256 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436; |
| Sequence | TCAGTGCTGCCCACTTGAAGGGTGGTGCTAAGAAAGTAGTTATTTCTGCTCCTAGCAAGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |