Detail of EST/Unigene SRR015436.92629 |
Acc. | SRR015436.92629 |
Internal Acc. | ESXKO2301DYD3C |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-45; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=6e-45; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=8e-45; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=1e-44; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=2e-44; |
Length | 259 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436; |
Sequence | TCAGCGTTACGTGCCAAAAGCTCGGGGAAAACACATCCAAGAGCACCAAGCATGGCCCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |