Detail of EST/Unigene SRR027939.115982 |
Acc. | SRR027939.115982 |
Internal Acc. | FAN5VQW01CQYUU |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=4e-14; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Mesembryanthemum crystallinum E-value=4e-14; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Hordeum vulgare E-value=9e-14; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Dianthus caryophyllus E-value=2e-13; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ranunculus acris E-value=2e-13; |
Length | 319 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SRR027939; |
Sequence | TCAGTGACCACTGTTCACGCCATGACTGCCACCCAGAAAACTGTTGATGGTCCATCCATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |