Detail of EST/Unigene SRR027939.163258 |
Acc. | SRR027939.163258 |
Internal Acc. | FAN5VQW01AL2H6 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=1e-30; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=6e-29; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=5e-26; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=2e-19; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=4e-19; |
Length | 238 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SRR027939; |
Sequence | TCAGCTTTCCCACGGCGCTTCATCTCATTGTCAACAGCGTTGCAACACACCGTGCACCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |