| Detail of EST/Unigene SRR027939.178213 |
| Acc. | SRR027939.178213 |
| Internal Acc. | FAN5VQW02F6EFV |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=5e-34; 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=1e-33; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=5e-28; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=2e-17; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=2e-17; |
| Length | 254 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939; |
| Sequence | TCAGAGTAGTTCCACTCTTCTTGAACACTGGCTTCAATTTTGCCAAGTCTGACACACTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |