| Detail of EST/Unigene SRR027939.201944 |
| Acc. | SRR027939.201944 |
| Internal Acc. | FAN5VQW02G8LKN |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=6e-33; Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=6e-33; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=5e-32; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=2e-24; Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Dictyostelium discoideum E-value=2e-22; |
| Length | 234 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939; |
| Sequence | TCAGACTTTGGAGAGCGTGATTGCAGTATTCAGAGAAGAAATCAAAAGTTGCTGGAGGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |