Detail of EST/Unigene SRR027939.250274 |
Acc. | SRR027939.250274 |
Internal Acc. | FAN5VQW02GA7OT |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Craterostigma plantagineum E-value=1e-37; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=3e-37; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 1 OS=Zea mays E-value=4e-37; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Dianthus caryophyllus E-value=4e-37; Glyceraldehyde-3-phosphate dehydrogenase OS=Atriplex nummularia E-value=5e-37; |
Length | 244 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SRR027939; |
Sequence | TCAGATCGTTTCTAATGCTAGCTGTACTACTAACTGCCTTGCACCTCTGGCAAAGGTTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |