| Detail of EST/Unigene SRR027939.293531 |
| Acc. | SRR027939.293531 |
| Internal Acc. | FAN5VQW02FVKFE |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=9e-18; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=2e-17; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=4e-16; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=4e-13; Propionyl-CoA carboxylase alpha chain, mitochondrial OS=Homo sapiens E-value=4e-09; |
| Length | 270 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939; |
| Sequence | TCAGATAATTTTACGAACTCATTAGGTTCTTTAGCAAGACGCATTCCACGTCCACCACCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |