| Detail of EST/Unigene SRR027939.303048 |
| Acc. | SRR027939.303048 |
| Internal Acc. | FAN5VQW02JHSHQ |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit b, chloroplastic OS=Nicotiana tabacum E-value=2e-10; ATP synthase subunit b, chloroplastic OS=Panax ginseng E-value=2e-10; ATP synthase subunit b, chloroplastic OS=Manihot esculenta E-value=2e-10; ATP synthase subunit b, chloroplastic OS=Lactuca sativa E-value=2e-10; ATP synthase subunit b, chloroplastic OS=Helianthus annuus E-value=2e-10; |
| Length | 278 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939; |
| Sequence | TCAGGAGATCATATGAAAACGTAAACCGATTCTTTCGTTTTCTTTGGGCCACTGGCCATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |