Detail of EST/Unigene SRR027939.303048 |
Acc. | SRR027939.303048 |
Internal Acc. | FAN5VQW02JHSHQ |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit b, chloroplastic OS=Nicotiana tabacum E-value=2e-10; ATP synthase subunit b, chloroplastic OS=Panax ginseng E-value=2e-10; ATP synthase subunit b, chloroplastic OS=Manihot esculenta E-value=2e-10; ATP synthase subunit b, chloroplastic OS=Lactuca sativa E-value=2e-10; ATP synthase subunit b, chloroplastic OS=Helianthus annuus E-value=2e-10; |
Length | 278 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SRR027939; |
Sequence | TCAGGAGATCATATGAAAACGTAAACCGATTCTTTCGTTTTCTTTGGGCCACTGGCCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |