| Detail of EST/Unigene SRR027939.311634 |
| Acc. | SRR027939.311634 |
| Internal Acc. | FAN5VQW02IRC3W |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-2,3-enoyl-CoA reductase OS=Dictyostelium discoideum E-value=5e-13; Trans-2,3-enoyl-CoA reductase OS=Rattus norvegicus E-value=6e-08; Trans-2,3-enoyl-CoA reductase OS=Mus musculus E-value=6e-08; Trans-2,3-enoyl-CoA reductase OS=Homo sapiens E-value=1e-07; Trans-2,3-enoyl-CoA reductase OS=Bos taurus E-value=1e-07; |
| Length | 250 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939; |
| Sequence | TCAGGTCATTTATTGTTGAGAAATCTTCGAAGTCCCAGTGGTAATGGAGGTTACCAATAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |