Detail of EST/Unigene SRR027940.103960 |
Acc. | SRR027940.103960 |
Internal Acc. | EQNJ6P302HAWEC |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-37; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Silene pratensis E-value=2e-36; Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=3e-36; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=4e-36; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=1e-35; |
Length | 267 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940; |
Sequence | TCAGTAAGTACTTGGGCCCATTCTCTGGTGAATCACCAAGCTATTTGACTGGTGAGTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |