| Detail of EST/Unigene SRR027940.107153 |
| Acc. | SRR027940.107153 |
| Internal Acc. | EQNJ6P302IQ6WT |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=6e-29; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=5e-24; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=5e-23; Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=4e-21; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Silene pratensis E-value=9e-20; |
| Length | 303 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027940; |
| Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTGGTCCATTACGGCCGGGGATCATCAGCAAAAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |