| Detail of EST/Unigene SRR027940.108881 |
| Acc. | SRR027940.108881 |
| Internal Acc. | EQNJ6P302IAB9T |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ginkgo biloba E-value=1e-18; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Pinus sylvestris E-value=2e-18; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Taxus baccata E-value=4e-18; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=4e-18; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Pisum sativum E-value=4e-18; |
| Length | 178 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027940; |
| Sequence | TCAGATGCTAGCTGTACCACAAATTGCCTTGCTCCCTTGGCCAAGGTTATAAATGACAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |