Detail of EST/Unigene SRR027940.11821 |
Acc. | SRR027940.11821 |
Internal Acc. | EQNJ6P301CMTYI |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-42; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=3e-42; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=4e-42; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=4e-42; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=4e-42; |
Length | 278 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940; |
Sequence | TCAGGCTTGCCAAGTTGTGTTGATGGGAGCTTGTTGAGGGTTACCGTGTTGCTGGTGGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |