Detail of EST/Unigene SRR027940.35110 |
Acc. | SRR027940.35110 |
Internal Acc. | EQNJ6P301DF4NS |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-08; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-08; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=4e-08; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=4e-08; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=4e-08; |
Length | 272 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGATAGCAACAAACCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |