Detail of EST/Unigene SRR027940.60387 |
Acc. | SRR027940.60387 |
Internal Acc. | EQNJ6P302IIU7E |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=4e-14; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=4e-14; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=5e-14; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-14; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=5e-14; |
Length | 176 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940; |
Sequence | TCAGACAGCTTCACCAAATTTAACACCGTTACGTGCCAAAAGCTCGGGGAATACACATCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |