| Detail of EST/Unigene SRR027940.61562 |
| Acc. | SRR027940.61562 |
| Internal Acc. | EQNJ6P302H9PVI |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=8e-14; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-13; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=1e-13; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-13; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-13; |
| Length | 155 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027940; |
| Sequence | TCAGGGAAATTAAGAACGGCAGACTTGCTATGTTCTCCATGTTTGGATTCTTTGTTCAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |