| Detail of EST/Unigene SRR027940.66640 |
| Acc. | SRR027940.66640 |
| Internal Acc. | EQNJ6P302H0JTZ |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Solanum pennellii E-value=1e-07; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=5e-07; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=4e-06; |
| Length | 174 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027940; |
| Sequence | TCAGCTTTTTTCAAGGATTTTCCAAAGAAGGCTGTGCTTTGGAACGGAAGTTCCAGCAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |