Detail of EST/Unigene SRR027940.78637 |
Acc. | SRR027940.78637 |
Internal Acc. | EQNJ6P302FZGR5 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=6e-36; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-35; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=8e-35; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=1e-34; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=1e-34; |
Length | 285 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940; |
Sequence | TCAGTTTGGGCTTGCCAAGTTGTGTTGATGGGAGTCTGTTGAGGGTTACCGTGTTGCTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |