Detail of EST/Unigene SRR027940.83749 |
Acc. | SRR027940.83749 |
Internal Acc. | EQNJ6P302HG4JO |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=3e-12; Chlorophyll a-b binding protein, chloroplastic OS=Physcomitrella patens subsp. patens E-value=8e-12; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=1e-11; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=1e-11; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-11; |
Length | 190 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940; |
Sequence | TCAGCTGGTGGGCCTCTTGGTGAGGTTGTTGATTCCACTTTACCCTGGTGGTAGCTTTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |