Detail of EST/Unigene SRR027940.88099 |
Acc. | SRR027940.88099 |
Internal Acc. | EQNJ6P302FPAHC |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=2e-28; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=2e-23; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=2e-22; Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=1e-20; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Silene pratensis E-value=4e-19; |
Length | 299 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGATCATCAGCAAAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |