| Detail of EST/Unigene SRR027940.93870 |
| Acc. | SRR027940.93870 |
| Internal Acc. | EQNJ6P302HZAXY |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=5e-11; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=1e-10; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=1e-10; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=1e-10; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=1e-10; |
| Length | 161 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027940; |
| Sequence | TCAGCCCCAAGCTACTTGACCGGTGAATTCCCTGGTGTACTACGGCTGGGATACCGCTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |