Detail of EST/Unigene SRR027940.96375 |
Acc. | SRR027940.96375 |
Internal Acc. | EQNJ6P302IEEME |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-16; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=1e-15; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-15; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-15; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=4e-15; |
Length | 265 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTGGTCCATTACGGCCGGGGATAGCAACGAACCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |