| Detail of EST/Unigene SRR027941.116075 |
| Acc. | SRR027941.116075 |
| Internal Acc. | E4GDP0P01B2BP4 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=6e-30; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=7e-30; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=7e-30; Chlorophyll a-b binding protein 1A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=7e-30; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-30; |
| Length | 287 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGCGACCCATTAGGCCTTGCTGAAGACCCGGAGGCATTTGCTGAGCTCAAGGTAAAGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |