Detail of EST/Unigene SRR027941.160912 |
Acc. | SRR027941.160912 |
Internal Acc. | E4GDP0P01ER0ZT |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=9e-10; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=3e-09; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-08; |
Length | 280 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGTATTAATCCCACCAATAATCAAAGGATAACCAGGTTCCAATCGATGAAGGTCAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |