| Detail of EST/Unigene SRR027941.176992 |
| Acc. | SRR027941.176992 |
| Internal Acc. | E4GDP0P02GR0GG |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=4e-07; Naringenin,2-oxoglutarate 3-dioxygenase OS=Callistephus chinensis E-value=9e-07; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=3e-06; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=4e-06; |
| Length | 123 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGGTAAAATTGACAACTACTTTTTGGTCCATATCGACACATGCCTTGGTTAAAGCCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |