Detail of EST/Unigene SRR027941.180261 |
Acc. | SRR027941.180261 |
Internal Acc. | E4GDP0P02IWWY9 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-47; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-47; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=7e-47; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=9e-47; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=9e-47; |
Length | 279 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGGCGTTGTTGTTAACTGGGTCAGCAAGGTGGTCAGCAAGGTTCTCCAATGGTCCCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |