| Detail of EST/Unigene SRR027941.185253 |
| Acc. | SRR027941.185253 |
| Internal Acc. | E4GDP0P02IMWEK |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=2e-24; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-24; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=2e-24; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-24; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=2e-24; |
| Length | 265 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGTATGGTTCAAAGCTGGATCTCAAATTTTCAGCGAGGGCGGACTTGACTACTTGGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |