| Detail of EST/Unigene SRR027941.191954 |
| Acc. | SRR027941.191954 |
| Internal Acc. | E4GDP0P02G5B8X |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic OS=Arabidopsis thaliana E-value=8e-19; 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic OS=Hordeum vulgare E-value=8e-11; 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; |
| Length | 195 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGGAATATCAGGCCATTCTGCATTGTTTTGGGAAGAACCCTGAACTTAAAATAAATTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |