Detail of EST/Unigene SRR027941.203454 |
Acc. | SRR027941.203454 |
Internal Acc. | E4GDP0P02FZN0R |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=1e-26; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Homo sapiens E-value=3e-09; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Sus scrofa E-value=6e-09; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Rattus norvegicus E-value=7e-09; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Mus musculus E-value=7e-09; |
Length | 251 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGAGAGCTTTAGTCGATTGCTGTTCAATGATTTTCTAAGGAATGCTAGCTCTATTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |