Detail of EST/Unigene SRR027941.20546 |
Acc. | SRR027941.20546 |
Internal Acc. | E4GDP0P01AKW3Z |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-12; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-12; Chlorophyll a-b binding protein 1A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-11; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=3e-09; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-09; |
Length | 252 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTACGCGGGGAACTCATCACAGCAAACATCAAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |