Detail of EST/Unigene SRR027941.214585
Acc. SRR027941.214585
Internal Acc. E4GDP0P02JTSQB
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding of LHCII type 1 protein (Fragment) OS=Raphanus sativus E-value=3e-06; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-06; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-06; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-06; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=3e-06;
Length 120 nt
Species Solanum habrochaites
Belonged EST Libraries SRR027941;
Sequence TCAGAATCCAAACATGGAGAACATAGCAAGTCTGCCGTTCTTAATTTCCTTAACCTTAAG
CTCAGCAAAAGCCTCTCTGAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A