Detail of EST/Unigene SRR027941.220262 |
Acc. | SRR027941.220262 |
Internal Acc. | E4GDP0P02H58R8 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-11; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=3e-11; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-10; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-09; |
Length | 259 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTACGCGGGTAAACAATAAAGGCATACCAATTGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |