Detail of EST/Unigene SRR027941.228645 |
Acc. | SRR027941.228645 |
Internal Acc. | E4GDP0P02H6EPS |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-16; Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=5e-16; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=5e-16; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=6e-16; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-16; |
Length | 255 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGGAACCAAACTAGGGTTTCCCAAGTAGTCAAGTCCGCCCTCGCTGTAAAATTTGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |