| Detail of EST/Unigene SRR027941.234268 |
| Acc. | SRR027941.234268 |
| Internal Acc. | E4GDP0P02IV6K2 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-deoxy-D-xylulose 5-phosphate reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=1e-07; 1-deoxy-D-xylulose 5-phosphate reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-07; 1-deoxy-D-xylulose 5-phosphate reductoisomerase, chloroplastic OS=Mentha piperita E-value=4e-06; |
| Length | 202 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGAAGCAGTGGTATCAACGCAGAGTACGCGGGGGGACTGGCCAGTTGAGAAGTTGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |