| Detail of EST/Unigene SRR027941.235625 |
| Acc. | SRR027941.235625 |
| Internal Acc. | E4GDP0P02F6W27 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=3e-40; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=9e-40; UDP-arabinopyranose mutase 1 OS=Oryza sativa subsp. japonica E-value=9e-40; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=4e-39; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=4e-39; |
| Length | 272 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGTTCTTCTTAGACACCATATACCCAAAACACCTACAAGCAGAATCCTTAAAAGAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |