Detail of EST/Unigene SRR027941.235625 |
Acc. | SRR027941.235625 |
Internal Acc. | E4GDP0P02F6W27 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=3e-40; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=9e-40; UDP-arabinopyranose mutase 1 OS=Oryza sativa subsp. japonica E-value=9e-40; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=4e-39; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=4e-39; |
Length | 272 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGTTCTTCTTAGACACCATATACCCAAAACACCTACAAGCAGAATCCTTAAAAGAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |