Detail of EST/Unigene SRR027941.241950 |
Acc. | SRR027941.241950 |
Internal Acc. | E4GDP0P02F228H |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=1e-20; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=1e-20; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=4e-20; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ginkgo biloba E-value=5e-20; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Mesembryanthemum crystallinum E-value=2e-19; |
Length | 247 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGCATCACCAGCAGCGCCACCAACGAGTGAACTGCCACATTTACTGAACTGACGACAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |