Detail of EST/Unigene SRR027941.277095 |
Acc. | SRR027941.277095 |
Internal Acc. | E4GDP0P02G3CGM |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=2e-20; Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=4e-20; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=9e-20; Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Dictyostelium discoideum E-value=1e-13; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=1e-13; |
Length | 254 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGACAGAGGATATCATTTCTGTCACCGGATGCTCTACCTGAATACGAGTGTTCATTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |