Detail of EST/Unigene SRR027941.279565 |
Acc. | SRR027941.279565 |
Internal Acc. | E4GDP0P02IV739 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=8e-24; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=7e-17; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=7e-17; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Cricetulus griseus E-value=2e-16; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Bos taurus E-value=2e-16; |
Length | 255 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGGCTTGTTGGGCCTGATGCTCCTATAGTATTTGAAAGCAAGATCAGGGCTAGCCATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |