| Detail of EST/Unigene SRR027941.284019 |
| Acc. | SRR027941.284019 |
| Internal Acc. | E4GDP0P02HUH5A |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=3e-18; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=4e-18; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-18; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-18; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=5e-18; |
| Length | 263 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941; |
| Sequence | TCAGCATTCTCTGGTGAATCACCAAGCTATTTGACTGGTGAGTTCCCCGGTGATTACGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |