Detail of EST/Unigene SRR027941.293909 |
Acc. | SRR027941.293909 |
Internal Acc. | E4GDP0P02FKWB9 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-13; Chlorophyll a-b binding protein, chloroplastic OS=Physcomitrella patens subsp. patens E-value=7e-13; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=7e-13; Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=7e-13; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Silene pratensis E-value=7e-13; |
Length | 296 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941; |
Sequence | TCAGCAACAACCTCACCAAGAGGCCCACCCAGCAACACGGTAACCCTCAACAGCTCCCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |